reverse primers Search Results


reverse primer  (tiangen biotech co)
99
tiangen biotech co reverse primer
Reverse Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primers/10__26554_slash_sti__2024__9__3__605___612-64-23-43?v=tiangen+biotech+co
Average 99 stars, based on 1 article reviews
reverse primer - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier
reverse primers  (tiangen biotech co)
99
tiangen biotech co reverse primers
Reverse Primers, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primers/pmc11360247-139-19-32?v=tiangen+biotech+co
Average 99 stars, based on 1 article reviews
reverse primers - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier
human tert primers  (OriGene)
93
OriGene human tert primers
Human Tert Primers, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primers/pmc12204606-110-0-4?v=OriGene
Average 93 stars, based on 1 article reviews
human tert primers - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag  (Thermo Fisher)
86
Thermo Fisher forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag
Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primers/10__1161_slash_circgenetics__113__000023-357-51-93?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier
mneon reverse primer  (Microsynth ag)
90
Microsynth ag mneon reverse primer
<t>PCR</t> and Western blot analysis results of CRISPitope-engineered melanoma cells (A) Depiction of engineered endogenous CDK4 mut fusion products with <t>mNeon</t> (top) and NF-hgp100 tag (bottom). (B) Detection of mNeon and NF-hgp100 tag by PCR analysis of genomic DNA (gDNA) and complementary DNA (cDNA) from non-engineered HC.PmelKO and CRISPitope-engineered HC.PmelKO.CDK4 mut -mNeon and HC.PmelKO.CDK4 mut -NF-hgp100 melanoma cells. Amplified region (CRISPitope amplicon) is depicted. β-Actin was used as loading control. (C) Western blot analysis of CDK4 expression in CRISPitope-engineered melanoma cells. β-Actin was used as loading control. Images from (A) and (C) were taken from <xref ref-type=Effern et al. (2020) . " width="250" height="auto" />
Mneon Reverse Primer, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primers/pmc08755566-114-0-7?v=Microsynth+ag
Average 90 stars, based on 1 article reviews
mneon reverse primer - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
gapdh (forward primer: 5′–aatcccatcaccatcttcca–3′; reverse primer: 5′–tggactccacgacgtactca–3′)  (GenScript corporation)
90
GenScript corporation gapdh (forward primer: 5′–aatcccatcaccatcttcca–3′; reverse primer: 5′–tggactccacgacgtactca–3′)
<t>PCR</t> and Western blot analysis results of CRISPitope-engineered melanoma cells (A) Depiction of engineered endogenous CDK4 mut fusion products with <t>mNeon</t> (top) and NF-hgp100 tag (bottom). (B) Detection of mNeon and NF-hgp100 tag by PCR analysis of genomic DNA (gDNA) and complementary DNA (cDNA) from non-engineered HC.PmelKO and CRISPitope-engineered HC.PmelKO.CDK4 mut -mNeon and HC.PmelKO.CDK4 mut -NF-hgp100 melanoma cells. Amplified region (CRISPitope amplicon) is depicted. β-Actin was used as loading control. (C) Western blot analysis of CDK4 expression in CRISPitope-engineered melanoma cells. β-Actin was used as loading control. Images from (A) and (C) were taken from <xref ref-type=Effern et al. (2020) . " width="250" height="auto" />
Gapdh (Forward Primer: 5′–Aatcccatcaccatcttcca–3′; Reverse Primer: 5′–Tggactccacgacgtactca–3′), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primers/pmc11280363-36-11-21?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
gapdh (forward primer: 5′–aatcccatcaccatcttcca–3′; reverse primer: 5′–tggactccacgacgtactca–3′) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
moloney murine leukemia virus reverse transcriptase i with an oligo dt primer mix  (Promega)
90
Promega moloney murine leukemia virus reverse transcriptase i with an oligo dt primer mix
<t>PCR</t> and Western blot analysis results of CRISPitope-engineered melanoma cells (A) Depiction of engineered endogenous CDK4 mut fusion products with <t>mNeon</t> (top) and NF-hgp100 tag (bottom). (B) Detection of mNeon and NF-hgp100 tag by PCR analysis of genomic DNA (gDNA) and complementary DNA (cDNA) from non-engineered HC.PmelKO and CRISPitope-engineered HC.PmelKO.CDK4 mut -mNeon and HC.PmelKO.CDK4 mut -NF-hgp100 melanoma cells. Amplified region (CRISPitope amplicon) is depicted. β-Actin was used as loading control. (C) Western blot analysis of CDK4 expression in CRISPitope-engineered melanoma cells. β-Actin was used as loading control. Images from (A) and (C) were taken from <xref ref-type=Effern et al. (2020) . " width="250" height="auto" />
Moloney Murine Leukemia Virus Reverse Transcriptase I With An Oligo Dt Primer Mix, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primers/pm24119802-64-24-28?v=Promega
Average 90 stars, based on 1 article reviews
moloney murine leukemia virus reverse transcriptase i with an oligo dt primer mix - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
oligo-(dt) primer and improm-ii reverse transcription system  (Promega)
90
Promega oligo-(dt) primer and improm-ii reverse transcription system
<t>PCR</t> and Western blot analysis results of CRISPitope-engineered melanoma cells (A) Depiction of engineered endogenous CDK4 mut fusion products with <t>mNeon</t> (top) and NF-hgp100 tag (bottom). (B) Detection of mNeon and NF-hgp100 tag by PCR analysis of genomic DNA (gDNA) and complementary DNA (cDNA) from non-engineered HC.PmelKO and CRISPitope-engineered HC.PmelKO.CDK4 mut -mNeon and HC.PmelKO.CDK4 mut -NF-hgp100 melanoma cells. Amplified region (CRISPitope amplicon) is depicted. β-Actin was used as loading control. (C) Western blot analysis of CDK4 expression in CRISPitope-engineered melanoma cells. β-Actin was used as loading control. Images from (A) and (C) were taken from <xref ref-type=Effern et al. (2020) . " width="250" height="auto" />
Oligo (Dt) Primer And Improm Ii Reverse Transcription System, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primers/pmc03401106-282-15-19?v=Promega
Average 90 stars, based on 1 article reviews
oligo-(dt) primer and improm-ii reverse transcription system - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
specific forward primer and reverse primer using bestar sybrgreen qpcr mastermix  (DBI Bioscience)
90
DBI Bioscience specific forward primer and reverse primer using bestar sybrgreen qpcr mastermix
<t>PCR</t> and Western blot analysis results of CRISPitope-engineered melanoma cells (A) Depiction of engineered endogenous CDK4 mut fusion products with <t>mNeon</t> (top) and NF-hgp100 tag (bottom). (B) Detection of mNeon and NF-hgp100 tag by PCR analysis of genomic DNA (gDNA) and complementary DNA (cDNA) from non-engineered HC.PmelKO and CRISPitope-engineered HC.PmelKO.CDK4 mut -mNeon and HC.PmelKO.CDK4 mut -NF-hgp100 melanoma cells. Amplified region (CRISPitope amplicon) is depicted. β-Actin was used as loading control. (C) Western blot analysis of CDK4 expression in CRISPitope-engineered melanoma cells. β-Actin was used as loading control. Images from (A) and (C) were taken from <xref ref-type=Effern et al. (2020) . " width="250" height="auto" />
Specific Forward Primer And Reverse Primer Using Bestar Sybrgreen Qpcr Mastermix, supplied by DBI Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primers/pm40468088-37-41-45?v=DBI+Bioscience
Average 90 stars, based on 1 article reviews
specific forward primer and reverse primer using bestar sybrgreen qpcr mastermix - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
forward and reverse primers  (Johns Hopkins HealthCare)
90
Johns Hopkins HealthCare forward and reverse primers
<t>PCR</t> and Western blot analysis results of CRISPitope-engineered melanoma cells (A) Depiction of engineered endogenous CDK4 mut fusion products with <t>mNeon</t> (top) and NF-hgp100 tag (bottom). (B) Detection of mNeon and NF-hgp100 tag by PCR analysis of genomic DNA (gDNA) and complementary DNA (cDNA) from non-engineered HC.PmelKO and CRISPitope-engineered HC.PmelKO.CDK4 mut -mNeon and HC.PmelKO.CDK4 mut -NF-hgp100 melanoma cells. Amplified region (CRISPitope amplicon) is depicted. β-Actin was used as loading control. (C) Western blot analysis of CDK4 expression in CRISPitope-engineered melanoma cells. β-Actin was used as loading control. Images from (A) and (C) were taken from <xref ref-type=Effern et al. (2020) . " width="250" height="auto" />
Forward And Reverse Primers, supplied by Johns Hopkins HealthCare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primers/pmc01924773-55-20-13?v=Johns+Hopkins+HealthCare
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
reverse primer hbv cccr  (Biolegio bv)
90
Biolegio bv reverse primer hbv cccr
<t>PCR</t> and Western blot analysis results of CRISPitope-engineered melanoma cells (A) Depiction of engineered endogenous CDK4 mut fusion products with <t>mNeon</t> (top) and NF-hgp100 tag (bottom). (B) Detection of mNeon and NF-hgp100 tag by PCR analysis of genomic DNA (gDNA) and complementary DNA (cDNA) from non-engineered HC.PmelKO and CRISPitope-engineered HC.PmelKO.CDK4 mut -mNeon and HC.PmelKO.CDK4 mut -NF-hgp100 melanoma cells. Amplified region (CRISPitope amplicon) is depicted. β-Actin was used as loading control. (C) Western blot analysis of CDK4 expression in CRISPitope-engineered melanoma cells. β-Actin was used as loading control. Images from (A) and (C) were taken from <xref ref-type=Effern et al. (2020) . " width="250" height="auto" />
Reverse Primer Hbv Cccr, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primers/10__1007_slash_978___1___61779___937___2-2280-24-34?v=Biolegio+bv
Average 90 stars, based on 1 article reviews
reverse primer hbv cccr - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
reverse primer caccacccaatttttgggca  (GenScript corporation)
90
GenScript corporation reverse primer caccacccaatttttgggca
<t>PCR</t> and Western blot analysis results of CRISPitope-engineered melanoma cells (A) Depiction of engineered endogenous CDK4 mut fusion products with <t>mNeon</t> (top) and NF-hgp100 tag (bottom). (B) Detection of mNeon and NF-hgp100 tag by PCR analysis of genomic DNA (gDNA) and complementary DNA (cDNA) from non-engineered HC.PmelKO and CRISPitope-engineered HC.PmelKO.CDK4 mut -mNeon and HC.PmelKO.CDK4 mut -NF-hgp100 melanoma cells. Amplified region (CRISPitope amplicon) is depicted. β-Actin was used as loading control. (C) Western blot analysis of CDK4 expression in CRISPitope-engineered melanoma cells. β-Actin was used as loading control. Images from (A) and (C) were taken from <xref ref-type=Effern et al. (2020) . " width="250" height="auto" />
Reverse Primer Caccacccaatttttgggca, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primers/pm36535957-201-8-12?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
reverse primer caccacccaatttttgggca - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results


PCR and Western blot analysis results of CRISPitope-engineered melanoma cells (A) Depiction of engineered endogenous CDK4 mut fusion products with mNeon (top) and NF-hgp100 tag (bottom). (B) Detection of mNeon and NF-hgp100 tag by PCR analysis of genomic DNA (gDNA) and complementary DNA (cDNA) from non-engineered HC.PmelKO and CRISPitope-engineered HC.PmelKO.CDK4 mut -mNeon and HC.PmelKO.CDK4 mut -NF-hgp100 melanoma cells. Amplified region (CRISPitope amplicon) is depicted. β-Actin was used as loading control. (C) Western blot analysis of CDK4 expression in CRISPitope-engineered melanoma cells. β-Actin was used as loading control. Images from (A) and (C) were taken from <xref ref-type=Effern et al. (2020) . " width="100%" height="100%">

Journal: STAR Protocols

Article Title: CRISPitope: A generic platform to model target antigens for adoptive T cell transfer therapy in mouse tumor models

doi: 10.1016/j.xpro.2021.101038

Figure Lengend Snippet: PCR and Western blot analysis results of CRISPitope-engineered melanoma cells (A) Depiction of engineered endogenous CDK4 mut fusion products with mNeon (top) and NF-hgp100 tag (bottom). (B) Detection of mNeon and NF-hgp100 tag by PCR analysis of genomic DNA (gDNA) and complementary DNA (cDNA) from non-engineered HC.PmelKO and CRISPitope-engineered HC.PmelKO.CDK4 mut -mNeon and HC.PmelKO.CDK4 mut -NF-hgp100 melanoma cells. Amplified region (CRISPitope amplicon) is depicted. β-Actin was used as loading control. (C) Western blot analysis of CDK4 expression in CRISPitope-engineered melanoma cells. β-Actin was used as loading control. Images from (A) and (C) were taken from Effern et al. (2020) .

Article Snippet: mNeon reverse primer (for PCR) 5′-CGCTTGCCATTTCCAGTGG-3′ , Microsynth , N/A.

Techniques: Western Blot, Amplification, Control, Expressing

Journal: STAR Protocols

Article Title: CRISPitope: A generic platform to model target antigens for adoptive T cell transfer therapy in mouse tumor models

doi: 10.1016/j.xpro.2021.101038

Figure Lengend Snippet:

Article Snippet: mNeon reverse primer (for PCR) 5′-CGCTTGCCATTTCCAGTGG-3′ , Microsynth , N/A.

Techniques: Purification, Virus, Recombinant, Saline, Binding Assay, Red Blood Cell Lysis, Staining, Transfection, DNA Purification, Plasmid Preparation, DNA Extraction, Sequencing, Software, Spectrophotometry